The Nervous System, Part 3 - Synapses!: Crash Course Anatomy - YouTube A bundle of axons is referred to as a tract in the CNS and as a nerve in the PNS. Neurons carry messages throughout the body, including sensory information from external stimuli and signals from the brain to different muscle groups in the body. Verywell Mind content is rigorously reviewed by a team of qualified and experienced fact checkers. Gap junctions are large enough to allow the flow of small cellular molecules like ATP or second messengers. A key point is that postsynaptic potentials arent instantaneous: instead, they last for a little while before they dissipate. The synapse, with its neurotransmitter, acts as a physiological valve, directing the conduction of nerve impulses in regular circuits and preventing random or chaotic stimulation of nerves. Peripheral nerves. Wise, Eddie Johnson, Brandon Poe, Dean H. Kruse, Oksana Korol, Jody E. Johnson, Mark Womble, Peter DeSaix. If the net flow of positively charged ions into the cell is large enough, then the PSP is excitatory; that is, it can lead to the generation of a new nerve impulse, called an action potential. Why ACTH can not go back to the presynaptic neuron directly, but has to be broken down and brought back? Direct link to natascha.b2000's post Why are the neurotransmit, Posted 3 years ago. Ligand-activated ion channels typically produce very quick physiological responses. Each neuron forms about 2,000 synapses. As an Amazon Associate we earn from qualifying purchases. Autonomic functions are distributed between central and peripheral regions of the nervous system. If you're behind a web filter, please make sure that the domains *.kastatic.org and *.kasandbox.org are unblocked. At a chemical synapse, the depolarization of an action potential reaching the presynaptic terminal causes release of neurotransmitters, which act on specialized receptors located in the cell membrane of the postsynaptic neuron. Most of the time, the neurotransmitter will then be taken back up by the neuron that released it, in a process known as "reuptake". Vesicles containing neurotransmitters release their contents mainly through the active zone. These dendrites then receive chemical signals from other neurons, which are then converted into electrical impulses that are transmitted toward the cell body. Direct link to Sunny Yu's post Where is the ACTH broken , Posted 3 years ago. Neuronsare the basic building blocks ofthe nervous system. Quiz: Organic Molecules Chemical Reactions in Metabolic Processes This signal is the action potential which has a very characteristic shape based on voltage changes across the membrane in a given time period. Neurons communicate with one another at junctions called, At a chemical synapse, an action potential triggers the presynaptic neuron to release, A single neuron, or nerve cell, can do a lot! The Autonomic Nervous System - CliffsNotes That is, it either happens at its full strength, or it doesn't happen at all. Electrical Synapse Small Molecules by, Animation 8.4. There are about 1011 neurons in the CNS. The neurotransmitter may be broken down by an enzyme, it may be sucked back up into the presynaptic neuron, or it may simply diffuse away. Alternatively, a neurotransmitter that binds to a metabotropic receptor may change how the cell responds to a second neurotransmitter that acts through a ligand-activated channel. Many axons are insulated by a lipid-rich substance called myelin. Considering the anatomical regions of the nervous system, there are specific names for the structures within each division. The myelin sheath is broken up by points known as the nodes of Ranvier or myelin sheath gaps. The action potential travels down the axon as voltage-gated ion channels are opened by the spreading depolarization. Where do these receptors get their names? We covered the anatomy of the organs tasked to these actions and their functions. Question 14 60 seconds Q. Depolarization occurs because A synapse is a small gap at the end of a neuron that allows a signal to pass from one neuron to the next. Boston: Cengage Learning. These types of electrical synapses are very few numbers. Animation 8.3. The basis of the electrical signal within a neuron is the action potential that propagates down the axon. If the total strength of the signal exceeds the threshold limit of the axon hillock, the structure will fire a signal (known as an action potential) down the axon. Animation 8.2. Electrical synapse showing presynaptic cell, gap junction, post-synaptic cell, and movement of positive ions from pre-synaptic cell to post-synaptic cell. Plasticity is the ability of the brain to change and adapt to new information. Freberg LA. Synapses are key to the brain's function, especially when it comes to memory. These are considered unconventional or nontraditional neurotransmitters. Specific types of glial cells provide this insulation. However, the opening or closing of those channels are brief. These vesicles will then bind to the membrane of the presynaptic cell, releasing the neurotransmitters into the synapse. Squid giant synapse - Wikipedia The CNS is the brain and spinal cord. Anatomy of a Synapse Flashcards | Quizlet \begin{array}{ll}\begin{array}{l}\text { Sequence without } \\ \text { treatment: }\end{array} & -{\text { AATTGCCCGATCGATTAAGCCA }} \\ \text { Sequence with } & - \\ \text { treatment: } & \text { AATTGTTTGATCGATTAAGCTA } \\ & -\end{array} EPSPs are graded potentials that can initiate an AP in the axon, whereas IPSPs produce a graded potential that lessens the chance of an AP in an axon. Chemical transmission is more common, and more complicated, than electrical transmission. Updates? This gap is about 20 to 50 nanometre wide and is filled with extracellular fluid. All of the neurotransmitters we have discussed so far can be considered conventional neurotransmitters. Support the olfactory epithelium. They receive the incoming signals and transmit them to the cell body. The cell body (soma) contains the nucleus and cytoplasm. Activation of this synapse triggers a synchronous contraction of the mantle musculature, causing the forceful ejection of a jet of water from the mantle. Illustration of spatial summation. Chemical synapses are far more common. how many receptors on a garden variety human brain neuron? Dendrites receive info, axon sends info. start text, C, a, end text, start superscript, 2, plus, end superscript. If you're seeing this message, it means we're having trouble loading external resources on our website. The nervous system is characterized by electrical signals that are sent from one area to another. Gray matter is where nuclei are found and white matter is where tracts are found. When there is resting potential, the outside of the axon is negative relative to the inside. What Are Glial Cells and What Do They Do? The membrane of a postsynaptic fibre has many different kinds of receptors, and some presynaptic terminals release more than one type of neurotransmitter. The CNS is the brain and spinal cord. This is achieved through transmission through synapses. The nucleus of a neuron is where genetic material is stored. IPSPs are important because they can counteract, or cancel out, the excitatory effect of EPSPs. They have certain regions that are binding sites for the neurotransmitter, as well as membrane-spanning segments that make up the channel. Hi, can I know what's the difference between muscarinic and nicotinic receptors? 5. where any attempt at price competition or other departures from the agreed. Can we see electrical synapses in FMRI just like its name electrical? Well discuss these unconventional neurotransmitters at the end of article. The mechanism of synapse transmission can be divided into the presynaptic and postsynaptic mechanisms. A special division of the nervous system is the enteric nervous system, which is responsible for controlling the digestive organs. These neurotransmitters would diffuse away from the synaptic cleft or an enzyme would help clear the rest of the neurotransmitters. The special senses are the senses that have specialized organs devoted to them for vision hearing and balance also smell. We and our partners use data for Personalised ads and content, ad and content measurement, audience insights and product development. A man stands still on a large sheet of slick ice; in his hand he It is the main component of the central nervous system. Graded potentials produced by interactions between neurons at synapses are called postsynaptic potentials (PSPs). Each neuron may be connected to up to 10,000 other neurons, passing signals to each other via as many as 1,000 trillion synaptic connections. A neuron has three parts- a cell body, dendrites, and an axon ending at an axon terminal. Chemical transmission seems to have evolved in large and complex vertebrate nervous systems, where transmission of multiple messages over longer distances is required. The electrochemical gradients will drive direction of ion flow. 1999-2023, Rice University. For instance, some insecticides kill insects by inhibiting an enzyme that breaks down the neurotransmitter acetylcholine. Let's make this more concrete by looking at an example. It is also responsible for higher functions such . The nervous system can be separated into divisions on the basis of anatomy and physiology. The synapses allow electrical and chemical messages to be transmitted from the neuron to the other cells in the body. 3. The basis of the electrical signal is the controlled distribution of ions across the membrane. Electrical Synapse Ion Flow by Casey Henley is licensed under a Creative Commons Attribution Non-Commercial Share-Alike (CC BY-NC-SA) 4.0 International License. Dendrodendritic synapse- The dendrite of presynaptic neuron connect to the dendrite of the postsynaptic neuron. This either opens an ion channel or triggers a cascade reaction that generates a secondary messenger, which can generate a change in ionic permeability of the cell. The depolarization causes the opening of voltage-gated calcium channels so that calcium can enter the axon terminal through the active zone. Direct link to 's post What happens if receptor , Posted 5 years ago. Chemical synapses outnumber electrical synapses in the fully developed nervous system. If the electrical impulses transmitted inward toward the cell body are large enough, they will generate an action potential. 1 2 Neurotransmitter molecules are used by the presynaptic neuron to send a message across the cleft to the postsynaptic neuron. Synapses are the junctions between two or more neurons where impulses pass from one neuron to others. It has organelles like Nissl granules, Golgi apparatus, lysosomes, etc. Most synapses are chemical. Direct link to Ivana - Science trainee's post EPSPs are graded potentia, Posted 3 years ago. Direct link to Ivana - Science trainee's post Because it could cause po, Posted 4 years ago. Except where otherwise noted, textbooks on this site In this article, we'll take a closer look at the synapse and the mechanisms neurons use to send signals across it. Ligand-activated ion channels are large protein complexes. Electrically charged ions then flow through the channels into or out of the neuron. The increase in calcium ion concentration in the presynaptic terminals causes the discharge of the neurotransmitters from the vesicles. At the synapse, the terminal of a presynaptic cell comes into close contact with the cell membrane of a postsynaptic neuron. Some axons are covered with a fatty substance called myelin that acts as an insulator. Direct link to Ivana - Science trainee's post Acetylcholine interacts w, Posted 4 years ago. If you're seeing this message, it means we're having trouble loading external resources on our website. An Overview of the Different Parts of a Neuron. In other cases, the receptor is not an ion channel itself but activates ion channels through a signaling pathway. https://human-memory.net/brain-neurons-synapses/, https://www.ncbi.nlm.nih.gov/books/NBK27911/, https://www.ncbi.nlm.nih.gov/pubmed/29030434, https://www.us.elsevierhealth.com/vst-nurse-anesthesia-e-book-9780323444378.html?dmnum, https://jeb.biologists.org/content/218/4/506, https://www.ncbi.nlm.nih.gov/pubmed/3393601. The synaptic knob contains many mitochondria that provide energy for the different processes that occur in this region. Some metabotropic receptors have excitatory effects when they're activated (make the cell more likely to fire an action potential), while others have inhibitory effects. The neurotransmitter molecules released from presynaptic terminal diffuse across the cleft to reach the postsynaptic receptors. At the synapse, the terminal of a presynaptic cell comes into close contact with the cell membrane of a postsynaptic neuron. They help in exocytosis of the vesicles. 1. OpenStax is part of Rice University, which is a 501(c)(3) nonprofit. I do not know what :transactions_ you are speaking of, but I found this. This is an example of temporal summation. This substance transmits the nerve impulse to the postsynaptic fibre by diffusing across the synaptic cleft and binding to receptor molecules on the postsynaptic membrane. Take the quiz below and get to learn more about the topic. The transmitters then act on neurotransmitter receptors in the postsynaptic membrane. This area has a cluster of receptors for neurotransmitters embedded within the membrane. The consent submitted will only be used for data processing originating from this website. Jan 27, 2022 OpenStax. Signaling through these. Neurotransmitters are used to carry the signal across the synapse to other neurons. That's the main difference, but in terms of structure and function, they are analogically similar. Since the gap junctions allow diffusion of ions without any obstruction, the signal can flow bidirectionally through an electrical synapse. On the other hand, if an IPSP occurred together with the two EPSPs, it might prevent the membrane potential from reaching threshold and keep the neuron from firing an action potential. This sudden shift of electric charge across the postsynaptic membrane changes the electric polarization of the membrane, producing the postsynaptic potential, or PSP. Across the synaptic cleft, there is the post-synaptic cell surface covered in receptors (ligand-gated ion channels) for the neurotransmitter. Synaptic plasticity is also involved in addiction. A geneticist is interested in determining the locations of methylated cytosines within a fragment of DNA. Examples of ligand-activated ion channels, https://tbme.embs.org/2016/02/29/special-issue-brain/, https://www.ncbi.nlm.nih.gov/pubmed/22250860. The membrane is normally at rest with established Na+ and K+ concentrations on either side. Continue with Recommended Cookies. Electrical synapses transfer signals much faster than chemical synapses. This table isn't a comprehensive listing, but it does cover some of the most well-known conventional neurotransmitters. Direct link to Adithya Sharanya's post what makes an EPSP or IPS, Posted 3 years ago. Thus the ion channels in the postsynaptic membrane open up, and movement of ions occurs. Direct link to Anthony Thomas's post I know this article talke, Posted 3 years ago. 2015;9:137. doi:10.3389/fnana.2015.00137, Miller AD, Zachary JF. In a chemical synapse, the electrical activity in the presynaptic neuron triggers the release of chemical messengers, the neurotransmitters. The neurotransmitter must be inactivated or removed from the synaptic cleft so that the stimulus is limited in time. Direct link to Ivana - Science trainee's post You got confused because , Posted 5 years ago. Image showing what happens when action potential arrives at axon terminal, causing ion flow and depolarization of target cell. Graded potentials can be the result of sensory stimuli. Within the synaptic cleft, the neurotransmitter diffuses across and goes to the postsynaptic membrane. However, doesn't this influx on positive charge cause depolarization of the cell? The squid giant synapse (Fig 1) was first recognized by John Zachary Young in 1939.It lies in the stellate ganglion on each side of the midline, at the posterior wall of the squid's muscular mantle. intrinsic channel proteins. Dense tufts- these are filamentous projections present close to the vesicles. The molecules of neurotransmitter diffuse across the synaptic cleft and bind to receptor proteins on the postsynaptic cell. Neurotransmitters may excite or inhibit the neuron they bind to. She is an associate clinical professor of neurology at Tufts University. https://www.britannica.com/science/synapse, National Center for Biotechnology Information - Synapse. An action potential causes release of neurotransmitters from the presynaptic terminal into the synaptic cleft. We now know that synaptic transmission can be either electrical or chemicalin some cases, both at the same synapse! An example of data being processed may be a unique identifier stored in a cookie. The chemical binding action alters the shape of the receptors, initiating a series of reactions that open channel-shaped protein molecules. Fact checkers review articles for factual accuracy, relevance, and timeliness. In addition, different presynaptic and postsynaptic cells produce different neurotransmitters and neurotransmitter receptors, with different interactions and different effects on the postsynaptic cell. This may be, In some cases, these effects on channel behavior are direct: the receptor is a ligand-gated ion channel, as in the diagram above. Whats Causing Your Muscle Twitch and How to Treat It. This kind of bends the definitions of presynaptic and postsynaptic! What about temporal summation? At the synapse, the firing of an action potential in one neuronthe presynaptic, or sending, neuroncauses the transmission of a signal to another neuronthe postsynaptic, or receiving, neuronmaking the postsynaptic neuron either more or less likely to fire its own action potential. Please refer to the appropriate style manual or other sources if you have any questions. Posted 7 years ago. For the nervous system to function, neurons must be able to communicate with each other, and they do this through structures called synapses. Initially, it is at 70 mV, the resting potential. Direct link to anshuman28dubey's post is there any thing betwee, Posted 7 years ago. The somatic nervous system (SNS) is responsible for functions that result in moving skeletal muscles. While the voltage-gated Na+ channel is inactivated, absolutely no action potentials can be generated. The diameter of the axon also makes a difference as ions diffusing within the cell have less resistance in a wider space. and you must attribute OpenStax. The larger the diameter of the axon, the faster it transmits information. In some cases, neurotransmitter can also be "mopped up" by nearby glial cellsnot shown in the diagram below. Glycine is the main inhibitory neurotransmitter in the spinal cord. During synaptic pruning, the brain eliminates extra synapses. A synaptic connection between a neuron and a muscle cell is called a neuromuscular junction. The synapses are of different types and can be classified on the following bases. Electrical impulses are able to jump from one node to the next, which plays a role in speeding up the transmission of the signal. Neurons are cells that transmit information between your brain and other parts of the central nervous system. While electrical synapses have the advantage of speed, the strength of a signal diminishes as it travels from one cell to the next. The axon may be unmyelinated (no sheath) of myelinated. That input will result in opening ion channels in the neuron, resulting in a graded potential based on the strength of the stimulus. Electrical synapses are a physical connection between two neurons. Gap junctions are large enough to allow the flow of small cellular molecules like ATP or second messengers. If the sensory stimulus is received by a specialized sensory receptor cell, the graded potential is called a receptor potential. Give the original sequence of the DNA fragment and indicate the locations of methylated cytosines.\ Think of the nerve signal like the electrical current, and the neurons like wires. Direct link to Jenn Zeddis's post What happens with the unm. Two classes of unconventional transmitters are the. Action potentials are the fundamental units of communication between neurons and occur when the sum total of all of the excitatory and inhibitory inputs makes the neuron's membrane potential reach around -50 mV (see diagram), a value called the action potential threshold. firecracker and the motion of the center of mass of the system Synapses are found where neurons connect with other neurons. This results in the signal being transmitted down the axon., The soma, or cell body, is where the signals from the dendrites are joined and passed on. When a signal is received by the cell, it causes sodium ions to enter the cell and reduce the polarization. Our editors will review what youve submitted and determine whether to revise the article. 9. If the receptor for that neurotransmitter is ionotropic, the activation of that receptor will open or close certain ion channels, thereby altering the membrane potential of the postsynaptic cell. Once a nerve impulse has triggered the release of neurotransmitters, these chemical messengers cross the tiny synaptic gap and are taken up by receptors on the surface of the next cell. Instead, it must trigger the release of neurotransmitters which can then carry the impulse across the synapse to the next neuron. Direct link to Pravin Damle 's post I want to know about brai, Posted 3 years ago. These opposite effects are possible because two different types of acetylcholine receptor proteins are found in the two locations. Nervous System Terminology. Chemical transmission involves release of chemical messengers known as. Neuronal synapses questions (practice) | Khan Academy So, let's take a look at chemical transmission first. Direct link to Ivana - Science trainee's post A primordial neurosecreto, Posted 5 years ago. Also, electrical synapses allow for the synchronized activity of groups of cells. For example, naloxazone irreversibly binds to mu-opioid receptors, which prevent them from being activated from opioids. This figure depicts what a dendrite looks like in a neuron: Dendrites Function. In contrast, it is inhibitory in the heart, where it slows heart rate. Direct link to gjpalmer2's post how many receptors on a g, Posted 4 years ago. Brain is the central control system of the body. ments have landed but none has reached the edge of the ice. This unit includes a dissection of the sheep brain and a project on brain disorders. For instance, a sending neuron can "dial up" or "dial down" the amount of neurotransmitter it releases in response to the arrival of an action potential. A single axon can have multiple branches, allowing it to make synapses on various postsynaptic cells. holds a lighted firecracker. Bidirectional Electrical Synapse by Casey Henley is licensed under a Creative Commons Attribution Non-Commercial Share-Alike (CC BY-NC-SA) 4.0 International License. Moreover, studies on the postsynaptic protein homolog Homer revealed unexpected localization patterns in choanoflagellates and new binding partners, both of which are conserved in metazoans. then you must include on every digital page view the following attribution: Use the information below to generate a citation. Anatomy & Physiology - Nervous System Anatomy & Physiology Chapter 9: Nervous System This chapter is divided into three main sections: the neuron, parts and functions of the brain, and finally the cranial nerves. The nervous system can also be divided on the basis of how it controls the body. Certain populations of neurons only express receptors for certain neurotransmitters. 2023 Dotdash Media, Inc. All rights reserved. For the nervous system to function, neurons must be able to communicate with each other, and they do this through structures called synapses. Posted 5 years ago. Chemical synapses or one-way synapses as they transmit signals in one particular direction. Glycine, glutamic acid, and GABA structures. These variables account for the complex responses of the nervous system to any given stimulus. The ligand binds to the receptor, which triggers a signaling cascade inside the cell. The PNS is everything else. Knowing more about the different parts of the neuron can help you to better understand how these important structures function as well as how different problems, such as diseases that impact axon myelination, might impact how messages are communicated throughout the body. What happens if receptor sites for the NT were blocked. Some neurons have very small, short dendrites, while other cells possess very long ones. The neurotransmitter acetylcholine is excitatory at the neuromuscular junction in skeletal muscle, causing the muscle to contract. Quiz: The Synapse Anatomy and Chemistry Basics Quiz: What is Anatomy and Physiology? The axon (preganglionic axon) of a preganglionic neuron enters the ganglion and forms a synapse with the dendrites of the postganglionic neuron. These myelinated axons transmit information much faster than other neurons. Manage Settings Anatomy & Physiology - Nervous System - The Biology Corner Neurotransmitter binds to receptors on target cell (in this case, causing positive ions to flow in). PDF Neurotransmission Fact Sheet - National Institute on Drug Abuse Neurotransmitter Action: Ionotropic Receptors, 12. In addition, it also has control systems for the regulation of involuntary processes like respiratory rate, blood pressure, etc. There are many different kinds of neurotransmitters, and new ones are still being discovered! For a neuron to generate an action potential, it needs to receive input from another source, either another neuron or a sensory stimulus. Remember: Neurons transfer info TO and FROM the brain. The terminal of presynaptic neurons usually ends in a small bulbous enlargement called the terminal button or synaptic notch. View static image of animation. The Immune System and Other Body Defenses, Chemical Reactions in Metabolic Processes, Quiz: Chemical Reactions in Metabolic Processes, Connective Tissue Associated with Muscle Tissue, Quiz: Connective Tissue Associated with Muscle Tissue, Quiz: Structure of Cardiac and Smooth Muscle, Muscle Size and Arrangement of Muscle Fascicles, Quiz: Muscle Size and Arrangement of Muscle Fascicles, Quiz: The Ventricles and Cerebrospinal Fluid, Quiz: The Hypothalamus and Pituitary Glands, Quiz: Functions of the Cardiovascular System, Quiz: Specific Defense (The Immune System), Humoral and Cell-Mediated Immune Responses, Quiz: Humoral and Cell-Mediated Immune Responses, Quiz: Structure of the Respiratory System, Quiz: Structure of the Digestive Tract Wall, Online Quizzes for CliffsNotes Anatomy and Physiology QuickReview, 2nd Edition. Verywell Mind's content is for informational and educational purposes only. House the sense of smell. In most cases, the neurotransmitter is removed from the synapse very rapidly, thanks to enzymes that break it down or neighboring cells that take it up. However, in the case of Acetylcholine, there will be multiple copies of the enzyme known as acetylcholinesterase within the synapse that will break it down. This process causes a series of brief transmission events, each one taking place in only 0.5 to 4.0 milliseconds. Atoms, Molecules, Ions, and Bonds Quiz: Atoms, Molecules, Ions, and Bonds Inorganic Compounds Quiz: Inorganic Compounds Organic Molecules What Is Anatomy and Physiology? Transmembrane ion channels regulate when ions can move in or out of the cell, so that a precise signal is generated. If you would like to change your settings or withdraw consent at any time, the link to do so is in our privacy policy accessible from our home page.. Removing #book# Functions of electrical synapses in the nervous system rapid communication; ions or second messengers; usually bidirectional communication; excitation and inhibition at the same synapse; identified in the retina, cortex, brainstem (breathing), and hypothalamus (neuroendocrine neurons) Functional anatomy of chemical synapses Animation 8.1. are licensed under a, Structural Organization of the Human Body, Elements and Atoms: The Building Blocks of Matter, Inorganic Compounds Essential to Human Functioning, Organic Compounds Essential to Human Functioning, Nervous Tissue Mediates Perception and Response, Diseases, Disorders, and Injuries of the Integumentary System, Exercise, Nutrition, Hormones, and Bone Tissue, Calcium Homeostasis: Interactions of the Skeletal System and Other Organ Systems, Embryonic Development of the Axial Skeleton, Development and Regeneration of Muscle Tissue, Interactions of Skeletal Muscles, Their Fascicle Arrangement, and Their Lever Systems, Axial Muscles of the Head, Neck, and Back, Axial Muscles of the Abdominal Wall, and Thorax, Muscles of the Pectoral Girdle and Upper Limbs, Appendicular Muscles of the Pelvic Girdle and Lower Limbs, Basic Structure and Function of the Nervous System, Circulation and the Central Nervous System, Divisions of the Autonomic Nervous System, Organs with Secondary Endocrine Functions, Development and Aging of the Endocrine System, The Cardiovascular System: Blood Vessels and Circulation, Blood Flow, Blood Pressure, and Resistance, Homeostatic Regulation of the Vascular System, Development of Blood Vessels and Fetal Circulation, Anatomy of the Lymphatic and Immune Systems, Barrier Defenses and the Innate Immune Response, The Adaptive Immune Response: T lymphocytes and Their Functional Types, The Adaptive Immune Response: B-lymphocytes and Antibodies, Diseases Associated with Depressed or Overactive Immune Responses, Energy, Maintenance, and Environmental Exchange, Organs and Structures of the Respiratory System, Embryonic Development of the Respiratory System, Digestive System Processes and Regulation, Accessory Organs in Digestion: The Liver, Pancreas, and Gallbladder, Chemical Digestion and Absorption: A Closer Look, Regulation of Fluid Volume and Composition, Fluid, Electrolyte, and Acid-Base Balance, Human Development and the Continuity of Life, Anatomy and Physiology of the Male Reproductive System, Anatomy and Physiology of the Female Reproductive System, Development of the Male and Female Reproductive Systems, Maternal Changes During Pregnancy, Labor, and Birth, Adjustments of the Infant at Birth and Postnatal Stages, https://openstax.org/books/anatomy-and-physiology/pages/1-introduction, https://openstax.org/books/anatomy-and-physiology/pages/12-chapter-review, Creative Commons Attribution 4.0 International License.